From Snakes to Sequences in 24 Hours: Success!

As I type up my notes from the field, I can only imagine what Darwin would think about the advancements in technology used to answer questions about evolutionary biology today...

7/11/17 6:00 AM

We hit the ground running after sharing the last post at the airport.  Landing at around 6:00 AM in Quito, Ecuador, we were greeted by our collaborators Lucas Bustamante (Tropical Herping) and Dr. David Salazar (Universidad Indoamerica), threw our gear in the truck, and swung by the University lab to pick up our final crew member, Nicolás Peñafiel. All the equipment and reagents for sequencing appeared to have traveled well on ice packs (at least we hoped so!), so we transferred our frozen material into a cooler and were off to the Chocó rainforest of Ecuador.

The "boat" responsible for transferring our vehicle across the Canandé river

7/11/17 3:00 PM

After several hours of driving through bumpy jungle roads and crossing the Canandé river on a questionable boat, we arrived at the small lodge nestled in the Chocó rainforest and rendezvoused with the rest of the team, who arrived a couple days ahead of us, including Alejandro Arteaga, Frank Pichardo, and Cesar Barrio Amorós.

Our goal was to survey the region for unique reptiles and amphibians and use the portable laboratory to sequence DNA right there in the field, so no time to waste! Nico and I unpacked the lab equipment and at around 8:24 PM began a few DNA extractions on a whip snake sample using a salt extraction protocol and the DNeasy kit protocol. Then as night fell, we grabbed our headlamps and were out in search of new targets. After several hours spotting numerous frogs and geckos, Frank stumbled upon a gorgeous eyelash viper just off trail.

Eyelash viper posing on the MinION DNA sequencer

A beautiful shot of our viper next to the MinION by Lucas Bustamante

7/11/17 11:34 PM

Back at the lodge that evening, we prepped a PCR run using the miniPCR and let it go overnight. Time for some rest.

7/12/17 10:15 AM

While Alejandro took digital white background images of the animals from last night, Nico and I made a gel to visualize the PCR product. The small electrophoresis chamber Nico brought from the lab worked well, but unfortunately my small UV flashlight was unable to really pick up fluorescence in the gel to visualize amplicons. I had tested this out briefly in the US before the trip and was able to pick up bands in a pitch black room, but I think the UV light wasn't quite strong enough under field conditions. Some of the bands appeared to be there which was encouraging, but next time I think it would be beneficial to tinker with a small transilluminator like the one also made by miniPCR.

7/12/17 11:30 AM

Alejandro wrapped up processing his specimens and extracting a small amount of blood or tail tissue from each, so I got to work extracting DNA for the eyelash viper and dwarf geckos. The extraction process with the DNeasy kit is easy (as the name implies!); as for equipment just requires a small centrifuge and the reagents can be stored at room temperature. After about an hour we had our fresh DNA samples.

Part of the DNA extraction and PCR set-up at our field site.

1:07 PM

Next I got started with a new round of PCR using primers for genes for 16S, cytb and ND4. These primers don't all necessarily have the same PCR conditions (such as annealing temperature) but for the sake of time and limitations with one miniPCR, I ran them together under the same settings.

3:25 PM

After a couple hours of PCR cycles, it was time for the second PCR barcding step. I used barcodes 1 through 8 for the samples and ran the new PCR protocol.

4:30 PM

Finally, it was time to start the library preparation for the nanopore sequencer using the SQK-LSK 1D kit. This involves the end-prep, adapter ligation and bead cleanup. Next it was time to prime the flow cell and load the sample.

The MinION (top) and miniPCR (bottom) make a great portable duo!

6:24 PM

I clicked "execute" for the MinKNOW software, began the sequencing run and said 'hold on to your butts' (one of my favorite quotes from Jurassic Park).

The MinION sequencer glowing red and blue as it runs off the power of my laptop.

Some of the sequence data produced from the MinION sequencer.

7:20 PM

After about an hour, I stopped the run after 16,484 reads had been generated, and ran the data through the Albacore program to demultiplex the reads into their individual barcode folders. I then took a peak in the barcodes and was excited to see the read lengths looked correct, so I downloaded barcode 1 and passed it along to Alejandro's laptop. Barcode 1 was the 16S sequence for the eyelash viper and Alejandro had a nice reference database on his laptop to compare the nanopore sequence to. After a few minutes of tinkering, Ale said "yes, it falls out with Bothriechis schlegelii!". This was it! The nanopore barcode was a complete match to the correct species!

BLAST hit result using a consensus read from the nanopore 16S barcode, which is a 98% match to the correct viper species. It will be interesting to see if the 2% difference is due to individual genetic variation, or if the difference is due to nanopore sequence error, which will be verified with Sanger sequencing of the same individual.

Components of the portable lab used on the trip. Left to right: miniPCR sitting atop the Poweradd battery, Vaio laptop with Geneious pro software to visualize sequence data, and the ONT MinION sequencer powered by the laptop.

In less than 24 hours from arriving at the field site and sampling snakes and geckos during our first night in the rainforest, we could verify species identification by creating a nanopore consensus and mapping to a pre-downloaded reference database. Now we are also verifying if some species collected are undescribed back at a lab in Quito, and will have everything Sanger sequenced to verify nanopore quality.

9:30 PM

After getting back from the field, Stefan set out to process the reads. While Geneious is good enough for a quick peek, it cannot deal with Nanopore-specific errors. After some quick tests using reference-based mapping (using bwa mem, samtools, angsd and nanopolish) it was clear we got good consensus sequences for all the 16S and the ND4 genes! However, CytB and COI did not amplify, which we verified on a gel back at Quito university a few days later, likely because we didn't have time to run multiple PCRs under optimal contitions for all the genes. Stefan then worked on tweaking de-novo assembly tools such as Canu and Allele Wrangler, to create consensus sequences without reference bias. All sequences from the field were later processed with Canu, which turned out to work pretty well for amplicon assembly.

Stefan working on his nanopore bioinformatics in the jungle.

Overall, we believe this is important becuase the Ecuadorian Chocó is a biodiversity hotspot which has lost more than 98% of habitat due in large part  to logging and palm oil agriculture. Rapid sequencing can be a useful  tool to better understand the diversity of life on our planet and use  that information for conservation. Furthermore, researchers in Quito do not have access to a Sanger sequencer let alone Next Generation Sequencing platforms within the country. Thus, Oxford Nanopore MinION sequencing enables them to rapidly process samples without the need to send them off internationally.

Some of the expedition team members! Left to right: Alejandro, Aaron, Frank and Lucas

Right now I'm still feeling a bit of relief and excitement that everything worked in one go in the field. This was an idea that I've been hoping to execute for a while now, and this seemed like the opportune time with a grant funding the project from National Geographic. The work isn't quite done yet, because we are verifying the quality of sequences, performing a few more experiments in lab, and writing all the methods and bioinformatics pipelines up for a publication with our Ecuadorian collaborators. While we quickly and successfully sequenced DNA in the field for correct species identification, this feels like just the beginning!

-Aaron & Stefan

Off to Ecuador: Portable DNA Sequencing for Rapid Species Identification in the Field

In the previous post I documented an experiment with the miniPCR amplifying barcodes to ultimately run on a portable gene sequencer (the MinION) developed by Oxford Nanopore Technologies. Here's the protocol on how I prepared the DNA for the MinION in a nutshell and how my colleague, Stefan Prost, and I have analyzed some of the data thus far.

First off, I pooled the 12 barcode PCR products from the miniPCR and began the library preparation using the 1D PCR barcoding amplicons (SQK-LSK108) Protocol. This has three primary steps, mainly End-prep, Adapter ligation, and AMpure XP bead binding. In the End-prep, you mix ~1 µg DNA with Ultra II End-prep reaction buffer & enzyme mix and heat for 5 minutes at 20 °C and 5 minutes at 65 °C, and clean with AMPure beads. Next, you mix the end-prepped DNA with Adapter mix, Blunt/TA Ligation master mix, wash with beads, add Adapter Bead Binding buffer, and elute. This all takes around a couple hours (although taking your time with the bead cleanups seems to help with DNA recovery) and now you’re ready to load the library-prepped DNA into the MinION flow cell!

Loading the sample into the MinION DNA sequencer, which runs off the power of your laptop

I started the sequencing run using the MinKNOW software on 7/3/17. First off, the software determines how many active pores the flow cell contains, which looked pretty good: 497 active pores in group 1, 407 in group 2, 208 group 3, and 39 group 4. Then the run kicked off and the reads started flowing. About one hour in, roughly 15,000 reads had been produced, but it looked like my laptop was getting a bit sluggish (perhaps because I'm using an external SSD drive on my Vaio Sony laptop) and the pore count was dropping off. So I hit the stop acquire button, printed the MinKNOW report and the laptop seemed to catch up on the intensive computing required for the run. I saved the flow cell in the fridge and went on to check out the data from the reads. 

Report given by MinKNOW. No surprise that most of the reads are short length (all the amplicons were ~600 bp to ~1.2 kb. The longer reads are likely the control DNA that ONT provides to run concurrently with your sample.

Stefan Prost working on creating a consensus for the nanopore barcode reads

The barcode reads were basecalled and then demultiplexed with a program called Albacore, which split up barcodes 1 – 12 into different folders. I grabbed a few raw sequences from barcode 1 (the ALS 16S gene), threw it into a BLAST search, and to my pleasant surprise got a snake 16S BLAST hit! Other barcodes appeared to get the correct match as well, which was really encouraging.

Screen shot of some of the raw barcode nanopore data

The next step was to create a consensus for the barcode reads. To do so, we first tested reference based mapping. We used two references, the same PCR amplicon sequenced with Sanger and a reference for a different species from the same genus downloaded from NCBI. We then mapped the reads with BWA mem, an algorithm that can handle divergent reads and sorted and processed the reads using Samtools. We then called the consensus using ANGSD or Geneious, and mapped the reads back to it for post-mapping polishing of the consenus sequence. We performed the polishing using Nanopolish. We then assessed the consensus sequence quality using the Sanger sequence. We see a low error rate for base calls after polishing. The only difference between mapping against the Sanger read and the downloaded reference, was that we missed three few basepair long indels, which weren't present in the downloaded reference (from a different species). We are currently exploring de-novo approaches to create consensus sequences without the use of a reference sequence, such as a program called Canu and the LAST aligment tool.

So overall, after a test trial using the MiniPCR and MinION, we're ready to hit the jungles of Ecuador for real-time portable DNA sequencing! The trial looked promising for basecalling amplicons used for species identification, now to see if we can do it all in the field. Heading to the airport now with Stefan and will post updates soon!

-Aaron Pomerantz & Stefan Prost

Portable PCR! Testing the miniPCR for DNA sequencing in the field

I've recently been testing portable tools for a project to take the "lab into the field". One interesting little piece of equipment I heard about was the miniPCR, a portable thermocycler that has been used for field PCR experiments, for instance "A simple, economical protocol for DNA extraction and amplification where there is no lab".

I got my hands on one of these little gadgets and put it to the test this week to see if I could amplify genes commonly referred to as DNA "barcodes", which are used for species identification and molecular phylogenetic trees, such as: "Molecular phylogeny of Atractus (Serpentes, Dipsadidae), with emphasis on Ecuadorian species and the description of three new taxa ". This snake paper published by my colleagues in Ecuador utilized partial genes sequences of 16S, cytb, and ND4 genes to generate the snake phylogeny below:

Phylogeny depicting relationships within colubrid snakes of the genus Atractus (Arteaga et al. 2017)

My goal was to perform an experiment with the same DNA sequences as the snake paper using the miniPCR to determine if we can perform amplification of these genes outside of a lab setting. The end goal of the PCR amplification is to feed these sequences into the Oxford Nanopore Technologies (ONT) MinION, a portable gene sequencing machine.

The Oxford Nanopore MinION has a barcoding kit, which allows you to pool amplicons. Each primer used for amplification needs a special "universal tail" adapted beforehand, so I ordered primers for 16S, cytb, ND4, as well as COI with the ONT primer tails as follows:

5’ TTTCTGTTGGTGCTGATATTGC-[project-specific forward primer sequence] 3’

5’ ACTTGCCTGTCGCTCTATCTTC-[project-specific reverse primer sequence] 3’

So for example, the 16S primers looks like this:

16S_F_ONT: TTTCTGTTGGTGCTGATATTGCCGCCTGTTTAYCAAAAACAT

16S_R_ONT: ACTTGCCTGTCGCTCTATCTTCCCGGTCTGAACTCAGATCACGT

Now with the primers and miniPCR in hand, I just needed some snake DNA! Lucky for me, a graduate student colleague in another lab at UC Berkeley had plenty of snake samples to work with (below referred to as "ALS" and "BRK"), so we extracted DNA using a standard salt extraction protocol.

I whipped up a standard mix for a PCR reaction [10X PCR buffer (5 ul), MgCl2 (2 ul), dNTP (1 ul), H2O (~41 ul), Taq (platinum Taq) (0.5 ul)] using primers for 16S, cytb, ND4 and COI and ran the miniPCR under following settings:

To test the "portability" aspect of the miniPCR, I ran it at my apartment powered by an external Poweradd battery.

miniPCR + Poweradd battery = portable PCR combo

Here are the result of the first PCR run on a gel after a SPRI bead cleanup:

Left to right: two different ladders (1Kb+), ALS 16S (15.8 ng/ul), ALS ND4 (12.6 ng/ul), BRK 16S (10 ng/ul), BRK Cytb (11 ng/ul). The Drosophila (Dmel) COI samples didn't seem to amplify well.

So not bad with the first round of miniPCR! Overall, the lengths on the gel match the expected amplicon length (16S = 585 bp, ND4 = 901 bp, Cytb = 1209 bp). To play it on the safe side, I also had the amplicons sent off to our DNA sequencing facility on campus and confirmed that they were indeed a match to the expected genes. The exception was the Drosophila sample, which interestingly matched to a Drosophila endosymbiotic bacteria (Wolbachia).

Now for the ONT barcode kit, we need to perform one more round of PCR, this time adding the barcode adapters 1 through 12. I made the scheme below to add barcodes to each individual sample of reptile DNA: ALS and BRK (both reptile species from my colleague at Berkeley) as well as some insect samples Plodia (moth), Junonia (butterfly) from our lab, and a Junonia collected form Peru.

Barcode 1: ALS 16S

Barcode 2: ALS ND4

Barcode 3: BRK 16S

Barcode 4: BRK Cytb

Barcode 5: ALS Cytb

Barcode 6: BRK ND4

Barcode 7: Plodia COI

Barcode 8: Junonia Lab COI

Barcode 9: Junonia Peru COI

Barcode 10: ALS 16S + ALS ND4

Barcode 11: BRK 16S + Junonia Lab COI

Barcode 12: Plodia COI + Junonia Lab COI

The second PCR reaction looked like this: Barcode adapter (2ul), PCR DNA template, H2O (44-47 ul), PCR Master Mix (50 ul) and I let the miniPCR do its thing again:

And some of the gel results:

ALS 16S Barcode 1 (152 ng/ul), ALS ND4 Barcode 2 (156 ng/ul), BRK 16s Barcode 3 (168 ng/ul), BRK Cytb Barcode 4 (157 ng/ul)

So overall, I'm impressed with the miniPCR! It has been consistent and reliable in producing expected amplicons - all within the confines of my apartment kitchen! The Poweradd battery works well to make the miniPCR portable, and each run seems to use ~20-30% of the battery.

The next step involves pooling these barcoded amplicons and sequencing on the MinION, which I have recently done but will dedicate a whole post to the sequencing and analysis next. Stay tuned!

-Aaron